Sequence ID | >WENV170014093 |
Genome ID | AVFP01006899 |
Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
Species | |
Start position on genome | 929 |
End posion on genome | 1015 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aggcgcgcat |
tRNA gene sequence |
GCGGGCGTGGCGGAATTGGTAGACGCACCGGACTTAAAATCCGTTGGGCGGCAACGCCCG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170014093 Leu TAA t ACnn nnnnnnnnnn G - C C - G G - C G - C G - C C - G G - C T G T C G G C C A T A A G | | | | | A T G G C G G C C G G C G | | | T T G A C G C T A G A TGGGCGGCAACGCCCGT C T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |