Sequence ID | >WENV170014094 |
Genome ID | AVFP01006903 |
Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
Species | |
Start position on genome | 772 |
End posion on genome | 857 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
aaaacgcgat |
tRNA gene sequence |
GCGGGCGTGGTGGAATGGTAGACACATGGCACTTAAAATGCCTGGGCCGATAGGCCGTGC |
Downstream region at tRNA end position |
ccatttccgc |
Secondary structure (Cloverleaf model) | >WENV170014094 Leu TAA t ACCA ccatttccgc G - C C - G G - C G - C G - C C - G G - C T C T C G G C C A T A A G | | | | | G G G G T G G C C G G C G | | | T T T A C A C A G A GGGCCGATAGGCCGT T T G - C G - C C - G A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |