Sequence ID | >WENV170014142 |
Genome ID | AVFP01017244 |
Phylum/Class | [AVFP] microbial mat metagenome; pink berry consortia of the Sippewissett salt marsh |
Species | |
Start position on genome | 391 |
End posion on genome | 481 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
accggttagt |
tRNA gene sequence |
GGAGACGTGGCCGAGTGGTCGAAGGCGCTCCCCTGCTAAGGGAGTATACCTCAAAAGGGT |
Downstream region at tRNA end position |
gccttctttn |
Secondary structure (Cloverleaf model) | >WENV170014142 Ser GCT t GCCA gccttctttn G - C G - C A - T G - C A - T C - G G - C T A T T T C C C A T G A G + | | | | G G G C C G G A G G G C G | | | T T T A G G C C G A G TATACCTCAAAAGGGTATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |