Sequence ID | >WENV170014299 |
Genome ID | AYRE01000001 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 80415 |
End posion on genome | 80342 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
tagaagttat |
tRNA gene sequence |
GGTCTTGTAGCTTAGCCTGGATAGAGTAGTGGGTTTCGGCCCCACTGACCCGGGTTCGAA |
Downstream region at tRNA end position |
cagattctct |
Secondary structure (Cloverleaf model) | >WENV170014299 Arg TCG t Tttg cagattctct G - C G + T T - A C - G T - A T - A G - C T A T G G C C C A C C G A A | | | | | G T T T C G C C G G G C G + | | + T T G G A G T A T A A TGAC G - C T - A G - C G - C G - C T C T G T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |