Sequence ID | >WENV170014300 |
Genome ID | AYRE01000001 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 59470 |
End posion on genome | 59398 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
attttattta |
tRNA gene sequence |
AGTCCTATAGTGTAGTGGTCTATCATTTAAGGTTCTGAGCCTTATGACTCCGGTTCGAAT |
Downstream region at tRNA end position |
ttgtttatcc |
Secondary structure (Cloverleaf model) | >WENV170014300 Gln CTG a Attt ttgtttatcc A - T G - C T - A C - G C - G T - A A - T T A T A G G C C A T G A A | | | | | G G T G T G T C C G G C G | | + T T T T C A T C T A T TGAC T - A A - T A - T G - C G - C T G T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |