Sequence ID | >WENV170014301 |
Genome ID | AYRE01000001 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 56808 |
End posion on genome | 56732 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
ggtgacttgT |
tRNA gene sequence |
GAGTTGCTAGCTCAGCCTGGTTAGAGCGACGGACTCTTAATCCGTAGGCCGCGGGTTCGA |
Downstream region at tRNA end position |
actaatccat |
Secondary structure (Cloverleaf model) | >WENV170014301 Lys CTT T GTtt actaatccat G - C A - T G - C T - A T + G G - C C - G T A T T G C C C A C C G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGCC A - T C - G G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |