Sequence ID | >WENV170014303 |
Genome ID | AYRE01000002 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 787 |
End posion on genome | 870 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ctaatatttT |
tRNA gene sequence |
GCCAAAATCGCATAATCCGGTATTGCGCTAGTCTCGAAAACTAGTTCCTTTGGAATTGTG |
Downstream region at tRNA end position |
ttttatttta |
Secondary structure (Cloverleaf model) | >WENV170014303 Ser CGA T GTtt ttttatttta G - C C - G C - G A - T A - T A - T A - T T A T C A C C C A T A A C | | | | | A C T A C G G T G G G C C | | | T T G T T G C G T A G TTCCTTTGGAATT C - G T - A A - T G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |