Sequence ID | >WENV170014304 |
Genome ID | AYRE01000002 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 59688 |
End posion on genome | 59614 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttactatatt |
tRNA gene sequence |
GGGAACGTAGTATAACCTGGCTAGAATAAGCGGCTCCAACCCGCTGGATGGGGGTTCAAA |
Downstream region at tRNA end position |
ttctaaaaaa |
Secondary structure (Cloverleaf model) | >WENV170014304 Trp CCA t ACtt ttctaaaaaa G - C G + T G - C A - T A - T C - G G - C T A T C T T C C A C C A A A | + + | | A T T A T G G G G G G C G + | + T T G G A A T C T A A GGAT A - T G - C C - G G - C G - C C C T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |