Sequence ID | >WENV170014305 |
Genome ID | AYRE01000002 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 52803 |
End posion on genome | 52729 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tcaggtaatg |
tRNA gene sequence |
ACCACATTAGTGTAACCTGGTTAGCACCTATGGTTGTGGCTCATAGAGTCCGGGTTCAAA |
Downstream region at tRNA end position |
aatcgaaaca |
Secondary structure (Cloverleaf model) | >WENV170014305 His GTG g CCtt aatcgaaaca A - T C - G C - G A - T C - G A - T T + G T A T G G C C C A C C A A A | | | | | A T T G T G C C G G G C G + | | | T T G G C A C T T A C GAGT T - A A - T T - A G - C G + T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |