Sequence ID | >WENV170014306 |
Genome ID | AYRE01000002 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 38052 |
End posion on genome | 37969 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
acaacatatt |
tRNA gene sequence |
GTAGGGGTCGCCCAGTCCGGTCAAAGGCGCTGGATTTAGGCTCCAGTCTGTAAAGTTCGT |
Downstream region at tRNA end position |
ttttttaagt |
Secondary structure (Cloverleaf model) | >WENV170014306 Leu TAG t ACtc ttttttaagt G - C T - A A - T G + T G - C G - C G - C T A T T A C C C A C T G A C + | | | | A C C C C G G T G G G C G | | | T T G A G G C T C A A G TCTGTAAAGTTC C - G T - A G - C G - C A - T T C T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |