Sequence ID | >WENV170014308 |
Genome ID | AYRE01000007 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 33087 |
End posion on genome | 33168 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
atactatttt |
tRNA gene sequence |
GTGGAGTTAACGAAGTGGTCAAACGTGACCGACTCAAAATCGGTTCCTTATGGTTCAAGG |
Downstream region at tRNA end position |
tttctaaaat |
Secondary structure (Cloverleaf model) | >WENV170014308 Leu CAA t ACtt tttctaaaat G - C T - A G + T G - C A - T G - C T - A T G T T T C C C A T G A A | | | | | G G A G C A A A G G G C G | | | T T T A C G T C A A G TCCTTATGGTTC A - T C - G C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |