Sequence ID | >WENV170014309 |
Genome ID | AYRE01000009 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 6952 |
End posion on genome | 6877 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
attatattaa |
tRNA gene sequence |
GGTCTCATAGTCTAGTCTGGATATGACATCACCCTCCTAAGGTGAGGATCGGGAGTTCGA |
Downstream region at tRNA end position |
tttctaaatt |
Secondary structure (Cloverleaf model) | >WENV170014309 Arg CCT a GCtt tttctaaatt G - C G + T T - A C - G T + G C - G A - T T A T C C C T C A C T G A A | | | | | G T T C T G G G G A G C G | | | T T G T G A C A T A A GGATC T - A C - G A - T C - G C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |