Sequence ID | >WENV170014310 |
Genome ID | AYRE01000010 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 15176 |
End posion on genome | 15247 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
attcattaac |
tRNA gene sequence |
GGCGGGGTGGCCAAGTGGTTAAGGCAGTAGGCTGCAACCCTGCGATCGTGGGTTCAAATC |
Downstream region at tRNA end position |
gaatattggt |
Secondary structure (Cloverleaf model) | >WENV170014310 Cys GCA c Tttt gaatattggt G - C G - C C - G G - C G - C G + T G - C T A T C A C C C A T G A G | | | | | A G A C C G G T G G G C G | | | T T T A G G C T A A GATC G - C T + G A - T G - C G - C C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |