Sequence ID | >WENV170014313 |
Genome ID | AYRE01000021 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 10639 |
End posion on genome | 10712 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cgatactatt |
tRNA gene sequence |
GCCTTGTTAACTCAGTAGGTAGAGTGCGTGGCTGTTAACCACGATGTCACAGGTTCGAGT |
Downstream region at tRNA end position |
aaagtatgtc |
Secondary structure (Cloverleaf model) | >WENV170014313 Asn GTT t GCtc aaagtatgtc G - C C - G C - G T - A T - A G - C T - A T G T T G T C C A T G A A | | | | | G A C T C A A C A G G C G | | | | T T G G A G T T A G ATGTC C - G G - C T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |