Sequence ID | >WENV170014314 |
Genome ID | AYRE01000021 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 10769 |
End posion on genome | 10844 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
atataaccat |
tRNA gene sequence |
GACCTGTTAGTTCAGCCCGGTTAGAATGCTCGACTGATAATCGAGTGGTCCCCAGTTCAA |
Downstream region at tRNA end position |
tttaaaattc |
Secondary structure (Cloverleaf model) | >WENV170014314 Ile GAT t ACtt tttaaaattc G - C A - T C - G C - G T - A G - C T - A T A T G G G T C A C C G A A | | | | | A C C T T G C C C A G C G | | | + T T G G A A T T T A G TGGTC C - G T - A C - G G - C A - T C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |