Sequence ID | >WENV170014315 |
Genome ID | AYRE01000024 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1520 |
End posion on genome | 1444 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
catatatatT |
tRNA gene sequence |
AACGAAGTGGAGCAGTTAGGAGTGCTCGCCGGGCTCATAACCCGGAGGTCAGTGGTTCAA |
Downstream region at tRNA end position |
tttcaattct |
Secondary structure (Cloverleaf model) | >WENV170014315 Met CAT T ATtt tttcaattct A - T A - T C - G G - C A - T A - T G - C T A T T C A C C A T T G A G | | | | | A A C G A G A G T G G C G | | | | T T G G C T C A G T G AGGTC C - G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |