Sequence ID | >WENV170014317 |
Genome ID | AYRE01000032 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 13314 |
End posion on genome | 13241 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ttgaagtgat |
tRNA gene sequence |
GAGGACTTAGCTCAGTTGGTAGAGCACTGCCCTGAAGAGGCAGGGGTCCGGGGTTCAAGT |
Downstream region at tRNA end position |
ttttaaaatt |
Secondary structure (Cloverleaf model) | >WENV170014317 Phe GAA t ACtt ttttaaaatt G - C A - T G - C G + T A - T C - G T - A T G T G T C C C A T G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C T A A GGGTC C - G T - A G - C C - G C - G C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |