Sequence ID | >WENV170014318 |
Genome ID | AYRE01000037 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 9296 |
End posion on genome | 9381 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
ctcatatatt |
tRNA gene sequence |
GCCAAGGTCGCATAATCTGGTATTGCGCGGGACTGCTAATCTCGTTCCTTATGGAGCTGC |
Downstream region at tRNA end position |
ctttatgaaa |
Secondary structure (Cloverleaf model) | >WENV170014318 Ser GCT t GCTA ctttatgaaa G - C C - G C - G A - T A - T G + T G - C T A T T G C C C A T A A C + | | | | A C T A C G G C G G G C T | | | T T G T T G C G T A G TTCCTTATGGAGCT C - G G - C G + T G - C A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |