Sequence ID | >WENV170014320 |
Genome ID | AYRE01000115 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 52 |
End posion on genome | 134 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tatacatatt |
tRNA gene sequence |
GCCGAGGTCGCATAATCCGGTATTGCGCTAGACTGGAAATCTAGTTCGTTTCGAATTGCG |
Downstream region at tRNA end position |
tttttcaccc |
Secondary structure (Cloverleaf model) | >WENV170014320 Ser GGA t GCtt tttttcaccc G - C C - G C - G G - C A - T G + T G - C T A T T G C C C A T A A C + | | | | A C T A C G G C G G G C C | | | T T G T T G C G T A G TTCGTTTCGAATT C - G T - A A - T G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |