Sequence ID | >WENV170014321 |
Genome ID | AYRE01000116 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 9064 |
End posion on genome | 9150 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cttaaaaaaa |
tRNA gene sequence |
GCCTCTATGGTGAAACTGGTAAACACGTCGGATTCAAAATCCGATGACTTCACGGTCTTG |
Downstream region at tRNA end position |
ctactaaaaa |
Secondary structure (Cloverleaf model) | >WENV170014321 Leu CAA a ACCA ctactaaaaa G + T C - G C - G T - A C - G T - A A - T T G T C A G C C A C A A G | | | | | G T A G T G G T C G G C G | | | T T G A C A C T A A G TGACTTCACGGTCTT T - A C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |