Sequence ID | >WENV170014322 |
Genome ID | AYRE01000140 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 3806 |
End posion on genome | 3731 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tattgatcac |
tRNA gene sequence |
GGTCCTGTGGTCTAGTCTGGATATGATACTAGCCTTCTAAGCTGGGGATCAAGGGTTCGA |
Downstream region at tRNA end position |
aatattttgg |
Secondary structure (Cloverleaf model) | >WENV170014322 Arg TCT c GCtt aatattttgg G - C G + T T - A C - G C - G T - A G - C T A T T T C C C A C T G A G | | | | | G T T C T G A A G G G C G | | + T T G T G A T A T A A GGATC C - G T + G A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |