Sequence ID | >WENV170014323 |
Genome ID | AYRE01000140 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 3585 |
End posion on genome | 3510 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
agtttattat |
tRNA gene sequence |
CCTCCTTTAGTGTAGTCCGGCCTATCATCTCGGACTTTCGATCCGATGACCTGGGTTCAA |
Downstream region at tRNA end position |
ttttatattc |
Secondary structure (Cloverleaf model) | >WENV170014323 Glu TTC t GCtt ttttatattc C - G C - G T - A C - G C - G T - A T - A T A T G G C C C A C T G A A | + | | | A C T G T G C T G G G C G | | + T T G T C A T C C T A C TGAC T - A C - G G - C G - C A - T C A T G T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |