Sequence ID | >WENV170014326 |
Genome ID | AYRE01000483 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1445 |
End posion on genome | 1355 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cacaatttgt |
tRNA gene sequence |
GGAAGGATGGCTGAGTGGCTTAAGGCGCTCGCCTGGAAAGCGAGTATACGTTTATAGCGT |
Downstream region at tRNA end position |
ctattcaaaa |
Secondary structure (Cloverleaf model) | >WENV170014326 Ser GGA t ACCA ctattcaaaa G - C G - C A - T A - T G - C G - C A - T T A T A C C C C A T G A G | | | | | A G G T C G T G G G G C G + | | T T C A G G C T T A G TATACGTTTATAGCGTATC C - G T - A C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |