Sequence ID | >WENV170014327 |
Genome ID | AYRE01000562 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 2207 |
End posion on genome | 2131 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttaaaataga |
tRNA gene sequence |
CGGAGTGTAGCGCAGCCTGGTAGCGCACCTGGTTTGGGACCAGGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
tttataatca |
Secondary structure (Cloverleaf model) | >WENV170014327 Pro TGG a ACCA tttataatca C - G G - C G - C A - T G - C T - A G - C C A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |