Sequence ID | >WENV170014328 |
Genome ID | AYRE01000639 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 1527 |
End posion on genome | 1452 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tatgccctac |
tRNA gene sequence |
GGCCCCTTAGCTCAGTGGTTAGAGCGCACGACTCATAATCGTTCGGTCCCCAGTTCAAAT |
Downstream region at tRNA end position |
aattagaaaa |
Secondary structure (Cloverleaf model) | >WENV170014328 Met CAT c ACCA aattagaaaa G - C G - C C - G C - G C - G C - G T - A T A T G G G T C A T G A A | | | | | A G C T C G C C C A G C G | | | | T T T G A G C T A G CGGTC C T A - T C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |