Sequence ID | >WENV170014329 |
Genome ID | AYRE01000722 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 2530 |
End posion on genome | 2612 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
agagttcatt |
tRNA gene sequence |
GCCCATATCGCATAATCCGGTATTGCGCCAGACTTGAAATCTGGTTCCCATGGAATTGGC |
Downstream region at tRNA end position |
tttttataca |
Secondary structure (Cloverleaf model) | >WENV170014329 Ser TGA t GCtc tttttataca G - C C - G C - G C - G A - T T + G A - T T A T C T G C C A T A A C | + | | | A C T A C G G G C G G C C | | | T T G T T G C G T A G TTCCCATGGAATT C - G C - G A - T G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |