Sequence ID | >WENV170014330 |
Genome ID | AYRE01000834 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 2303 |
End posion on genome | 2228 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tgaaaattgt |
tRNA gene sequence |
GGGGGTATAGCTCAGCTGGTAGAGCACCTGCTTTGCAAGCAGGGGGTCAGCAGTTCGAAT |
Downstream region at tRNA end position |
agctatactc |
Secondary structure (Cloverleaf model) | >WENV170014330 Ala TGC t ACCA agctatactc G - C G - C G + T G - C G + T T - A A - T T A T T C G T C A C G A A | | | | | G T C T C G A G C A G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C C - G T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |