Sequence ID | >WENV170014336 |
Genome ID | AYRE01001199 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 492 |
End posion on genome | 417 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
tttaggaagt |
tRNA gene sequence |
GGCGCGATAGCTCAGTCGGTAGAGCAATGGATTGAAAATCCATGTGTCGACAGTTCGATT |
Downstream region at tRNA end position |
cttttactta |
Secondary structure (Cloverleaf model) | >WENV170014336 Phe GAA t ACCA cttttactta G - C G - C C - G G A C - G G - C A - T T T T C T G T C A T G A A | | | | | G C C T C G G A C A G C G | | | | T T G G A G C T A A GTGTC A - T T - A G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |