Sequence ID | >WENV170014338 |
Genome ID | AYRE01002699 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 827 |
End posion on genome | 751 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
nnnnnnnnna |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGTTAGAGCACTGTGTTGATAACGCAGGGGTCCCAAGTTCAAG |
Downstream region at tRNA end position |
ttaaaaaagt |
Secondary structure (Cloverleaf model) | >WENV170014338 Ile GAT a ACCA ttaaaaaagt G - C G - C G - C C - G G - C A - T T - A T G T G G T T C A T G A A | | | | | A T C T C G C C A A G C G | | | | T T G G A G C T T A A GGGTC C - G T - A G - C T + G G - C T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |