Sequence ID | >WENV170014340 |
Genome ID | AYRE01003275 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 513 |
End posion on genome | 589 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttcctgtagc |
tRNA gene sequence |
GCGCCCTTAGCTCAGCTGGATAGAGCACCTCCCTTCTAAGGAGGTGGTCGAAGGTTCGAA |
Downstream region at tRNA end position |
ctatttaaag |
Secondary structure (Cloverleaf model) | >WENV170014340 Arg TCT c ACCA ctatttaaag G + T C - G G - C C - G C - G C - G T - A T A T C T T C C A C G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C A T A A TGGTC C - G C - G T - A C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |