Sequence ID | >WENV170014341 |
Genome ID | AYRE01003468 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 246 |
End posion on genome | 157 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gaaaacatac |
tRNA gene sequence |
GGACAGTTGGGTGAGTGGCTGAAACCACATCCCTGCTAAGGATGCGTACTGGCAACGGTA |
Downstream region at tRNA end position |
ttgtttatga |
Secondary structure (Cloverleaf model) | >WENV170014341 Ser GCT c GCCA ttgtttatga G - C G - C A - T C - G A - T G - C T - A T A T C T C C C A T G A G | | | | | A G G T G G G A G G G C G | | | T T C A A C C T G A A CGTACTGGCAACGGTACC C - G A - T T - A C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |