Sequence ID | >WENV170014345 |
Genome ID | AYRE01004407 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 286 |
End posion on genome | 211 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ttatttattt |
tRNA gene sequence |
GGAGCTATAGCAAAGCTGGTAATGCCCCGGATTGCAAATCCGGTATGCGTTGGTTCGAGT |
Downstream region at tRNA end position |
tttcattctc |
Secondary structure (Cloverleaf model) | >WENV170014345 Cys GCA t TCCA tttcattctc G - C G - C A - T G - C C - G T - A A - T T G T C A G C C A C G A A | | + | | G T A A C G G T T G G C G | | | T T G A T G C T A C TATGC C - G C - G G - C G - C A - T T A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |