| Sequence ID | >WENV170014349 |
| Genome ID | AYRE01005605 |
| Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
| Species | |
| Start position on genome | 174 |
| End posion on genome | 98 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
ttcctgaatt |
| tRNA gene sequence |
GCTGATATAGCTCAGCCCGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCCCCAGTTCGAG |
| Downstream region at tRNA end position |
ttatttagtt |
| Secondary structure (Cloverleaf model) | >WENV170014349 Thr GGT
t ACCA ttatttagtt
G - C
C - G
T - A
G - C
A - T
T - A
A - T T G
T G G G T C A
C G A A | | | | | G
C C T C G C C C A G C
C | | | | T T
G G A G C
G T A G AGGTC
C - G
A - T
C - G
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |