Sequence ID | >WENV170014356 |
Genome ID | AYRE01006045 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 246 |
End posion on genome | 162 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
nnnnnnnngt |
tRNA gene sequence |
GGAGGGGTTCCCGAGTGGCCAAAGGGATCAGACTGTAAATCTGACGGCTCAGCCTTCGCT |
Downstream region at tRNA end position |
tctatatgtt |
Secondary structure (Cloverleaf model) | >WENV170014356 Tyr GTA t ACCA tctatatgtt G - C G - C A - T G - C G - C G - C G + T T A T C G A C C A T G A T | | | | | G G G C C C G C T G G C G | | | T T C A G G G C A A A CGGCTCAGCCTTC T - A C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |