Sequence ID | >WENV170014357 |
Genome ID | AYRE01006075 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 85 |
End posion on genome | 10 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tattgataaT |
tRNA gene sequence |
GGGCCTGTGGCTTAGTTCGGTATAGCACCGCCCTTGCAAGGCGGGGGCCCCGGGTTCAAA |
Downstream region at tRNA end position |
agtgtgcnnn |
Secondary structure (Cloverleaf model) | >WENV170014357 Ala TGC T ATtg agtgtgcnnn G - C G - C G + T C - G C - G T + G G - C T A T G G C C C A T G A G | | | | | A T T T C G C C G G G C C | | | T T G T A G C G T A A GGGCC C - G C - G G - C C - G C - G C A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |