Sequence ID | >WENV170014359 |
Genome ID | AYRE01006535 |
Phylum/Class | [AYRE] bioreactor metagenome; day 6 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 212 |
End posion on genome | 137 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
nnnnnnnntt |
tRNA gene sequence |
GCCCGAATAGCTCAGTCGGTAGAGCAGAGGATTGAAAATCCTCGTGTCCCTGGTTCAATT |
Downstream region at tRNA end position |
tatttaaaag |
Secondary structure (Cloverleaf model) | >WENV170014359 Phe GAA t ACCA tatttaaaag G - C C - G C - G C - G G - C A - T A - T T T T G G G C C A T G A A | | + | | A C C T C G C C T G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T T A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |