Sequence ID | >WENV170014364 |
Genome ID | AYRF01000498 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 621 |
End posion on genome | 705 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
attactcgat |
tRNA gene sequence |
GCCCGAGTGGTGGAATTGGTAGACACGACGGATTCAAAATCCGTTTTCTTCGGAAGTGAC |
Downstream region at tRNA end position |
tactttaaat |
Secondary structure (Cloverleaf model) | >WENV170014364 Leu CAA t ACCA tactttaaat G - C C - G C - G C - G G - C A - T G - C T G T C T G C C A T A A G | | | | | A T G G T G G A C G G C G | | | T T G A C A C T A G G TTTCTTCGGAAGT A - T C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |