Sequence ID | >WENV170014367 |
Genome ID | AYRF01000859 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 267 |
End posion on genome | 191 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aaagacgtga |
tRNA gene sequence |
GCACCCGTAGCTCAGCTGGATAGAGCGTTGCCCTCCGGAGGCAAAGGCCACAGGTTCGAC |
Downstream region at tRNA end position |
tctttggatg |
Secondary structure (Cloverleaf model) | >WENV170014367 Arg CCG a GCCA tctttggatg G - C C - G A - T C - G C - G C - G G - C T C T T G T C C A C G A A | | | | | G T C T C G A C A G G C G | | | | T T G G A G C A T A G AGGCC T - A T - A G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |