Sequence ID | >WENV170014368 |
Genome ID | AYRF01000859 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 141 |
End posion on genome | 66 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
agtattagtg |
tRNA gene sequence |
GCGGATGTAGCTCAGTTGGTAGAGCCCCGGATTGTGATTCCGGTTGTCGCGGGTTCAATC |
Downstream region at tRNA end position |
ttttttaatg |
Secondary structure (Cloverleaf model) | >WENV170014368 His GTG g CCCA ttttttaatg G - C C - G G - C G + T A - T T - A G - C C T T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A C TTGTC C - G C - G G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |