Sequence ID | >WENV170014370 |
Genome ID | AYRF01002479 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 420 |
End posion on genome | 345 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
ctgatgtaat |
tRNA gene sequence |
GGGGCCTTAGCTCAGTTGGTAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGACC |
Downstream region at tRNA end position |
aacttcctat |
Secondary structure (Cloverleaf model) | >WENV170014370 Ala GGC t ACCA aacttcctat G - C G - C G + T G - C C - G C - G T - A C C T T C G C C A T G A A | | | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |