Sequence ID | >WENV170014376 |
Genome ID | AYRF01005547 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 262 |
End posion on genome | 187 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ttaccgctat |
tRNA gene sequence |
CTCTCCATAGCTCAACAGGATAGAGCACCCGCCTCCTAAGCGGATGATCGGGGTTCGAGT |
Downstream region at tRNA end position |
catccaagac |
Secondary structure (Cloverleaf model) | >WENV170014376 Arg CCT t ACCA catccaagac C - G T - A C - G T - A C - G C - G A - T T G T G T C C C A C A A A | + | | | G A C T C G C G G G G C G | | | | T T G G A G C A T A A TGAT C A C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |