Sequence ID | >WENV170014378 |
Genome ID | AYRF01006372 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 414 |
End posion on genome | 339 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
acatagcagt |
tRNA gene sequence |
GCCTCAATAGCTCAGATGGTAGAGCAGGTCCTTCGTAAGGACAAGGTCGGGGGTTCGAGT |
Downstream region at tRNA end position |
taaccgcttt |
Secondary structure (Cloverleaf model) | >WENV170014378 Thr CGT t ACCA taaccgcttt G - C C - G C - G T - A C - G A - T A - T T G T C T C C C A A G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C T A A AGGTC G A G - C T - A C - G C - G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |