Sequence ID | >WENV170014379 |
Genome ID | AYRF01007840 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 177 |
End posion on genome | 85 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tccgcaagac |
tRNA gene sequence |
GGTGAGGTGGCCGAGAGGCCGAAGGCGCTCCCCTGCTAAGGGAGTATGTGGTTTATAGCC |
Downstream region at tRNA end position |
tttcttgcac |
Secondary structure (Cloverleaf model) | >WENV170014379 Ser GCT c GCCA tttcttgcac G - C G - C T - A G - C A - T G - C G - C T A T C T C C C A A G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C C G A G TATGTGGTTTATAGCCGCATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |