Sequence ID | >WENV170014384 |
Genome ID | AYRF01012342 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 288 |
End posion on genome | 214 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
ctcattatcc |
tRNA gene sequence |
GTCCCCATAGTTAAATGGATATAACAAGGTCCTCCTAAGACTTAGTTGCAGGTTCGATTC |
Downstream region at tRNA end position |
gtacttttat |
Secondary structure (Cloverleaf model) | >WENV170014384 Arg CCT c GCCA gtacttttat G - C T - A C - G C - G C - G C - G A - T T T T C G T C C A T A A A | | | | | G G A T T G G C A G G C G | | | | T T A T A A C T A A AGTT A - T G + T G - C T - A C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |