Sequence ID | >WENV170014386 |
Genome ID | AYRF01015074 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 147 |
End posion on genome | 221 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cgatgaagat |
tRNA gene sequence |
GCTGTGGTAGCTCAGTGGTAGAGCGCGTCATTGGTAATGACGAGGTCGGGAGTTCAATCC |
Downstream region at tRNA end position |
tcgttctccc |
Secondary structure (Cloverleaf model) | >WENV170014386 Thr GGT t ACCA tcgttctccc G - C C - G T - A G - C T - A G - C G + T C T T C C C T C A G A A | | | | | A T C T C G G G G A G C G | | | | T T G G A G C T A G AGGTC C - G G - C T - A C - G A - T T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |