Sequence ID | >WENV170014387 |
Genome ID | AYRF01015704 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 102 |
End posion on genome | 178 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tctttgcatc |
tRNA gene sequence |
GCCTCTTTAGCTCAGTTGGTTAGAGCGCTCGACTCATAATCGATCGGTCGCAGGTTCAAG |
Downstream region at tRNA end position |
tcccttccct |
Secondary structure (Cloverleaf model) | >WENV170014387 Met CAT c ACCA tcccttccct G - C C - G C - G T - A C - G T - A T - A T G T C G T C C A T G A A | | | | | A T C T C G G C A G G C G | | | | T T G G A G C T T A G CGGTC C T T - A C - G G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |