Sequence ID | >WENV170014388 |
Genome ID | AYRF01016733 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 176 |
End posion on genome | 261 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ccttggcaac |
tRNA gene sequence |
GCGAGGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCTATGGATGTGG |
Downstream region at tRNA end position |
ctgcttcaat |
Secondary structure (Cloverleaf model) | >WENV170014388 Leu CAG c ACCA ctgcttcaat G - C C - G G - C A - T G + T G - C G - C T G T C C C C C A T A A G | | | | | A T G G C G G G G G G C G | | | T T G A C G C T A G G TGTCCTATGGATGT C - G T - A A - T G + T C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |