Sequence ID | >WENV170014391 |
Genome ID | AYRF01019774 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 120 |
End posion on genome | 44 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttatgtaaac |
tRNA gene sequence |
GGCAATATAGCTCAGCTGGTTAGAGCATCGCATTCATAATGCGAGGGTCGCAGGTTCGAG |
Downstream region at tRNA end position |
tttttttttg |
Secondary structure (Cloverleaf model) | >WENV170014391 Met CAT c ACCA tttttttttg G - C G - C C - G A - T A - T T - A A - T T G T C G C C C A C G A A | | | | G T C T C G G C A G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |