Sequence ID | >WENV170014392 |
Genome ID | AYRF01019923 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 155 |
End posion on genome | 230 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
tgaattaagt |
tRNA gene sequence |
GGGGCTATAGCTCAGTTGGGAGAGCGCGACGCTGGCAGCGTTGAGGTCTGCGGTTCGAAC |
Downstream region at tRNA end position |
cttaatcttc |
Secondary structure (Cloverleaf model) | >WENV170014392 Ala GGC t ACCA cttaatcttc G - C G - C G + T G - C C - G T - A A - T C A T A C G C C A T G A A | | | | | G T C T C G T G C G G C G | | | | T T G G A G C G A G AGGTC C - G G + T A - T C - G G - C C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |