Sequence ID | >WENV170014406 |
Genome ID | AYRF01032262 |
Phylum/Class | [AYRF] bioreactor metagenome; day 18 sample from continuous culture bioreactor with low C:N ratio inoculated with sediment |
Species | |
Start position on genome | 20 |
End posion on genome | 106 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccacgtttgt |
tRNA gene sequence |
GCCAGTGTGATGGAATTGGTAGACATAGGGGATTCAAAATCCCCCGCCCTTAAAAGCGTG |
Downstream region at tRNA end position |
tgaacgcaaa |
Secondary structure (Cloverleaf model) | >WENV170014406 Leu CAA t ACCA tgaacgcaaa G + T C - G C - G A - T G - C T - A G - C T G T C G G C C A T A A G | | | | | G T G G T A G C C G G C G | | | T T G A C A T T A G A CGCCCTTAAAAGCGT G - C G - C G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |